Basic Information
| ANNInter ID | ANNInter31813 |
|---|---|
| Interaction Type | siRNA - circRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-2206 | ath_circ_008910 |
| Category | siRNA | circRNA |
| Coordinate | 4:10923265-10924180(.) | 1:24702223-24708683(.) |
| Interaction Sequence | ACG-GAUUUUACGGUUUUGACGAGA | UCCCGCCAAAACCGUAAAAUCACGU |
| Interaction Site | 1 - 24 | 3279 - 3303 |