Basic Information


ANNInter ID ANNInter31322
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-2020 URS000238A2BD_3702
Category siRNA lncRNA
Coordinate 4:9687064-9690490(.) 5:14424356-14483748(+)
Interaction Sequence AGAGAUUGACCCGCGGUACACUGC UUUAUUUAAUGAGGGUCAAUCUCC
Interaction Site 1 - 24 12164 - 12187

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network