Basic Information


ANNInter ID ANNInter30625
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-19899 URS00023E420C_3702
Category siRNA lncRNA
Coordinate 1:28703488-28704085(.)
Interaction Sequence UGAAAAGAAUUGAGAGAAUAGCCU AGGCUAUUGUCUCAAUUCUUUUCA
Interaction Site 1 - 24 25951 - 25974

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network