Basic Information


ANNInter ID ANNInter30093
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-19648 URS000239E017_3702
Category siRNA lncRNA
Coordinate 1:26881115-26882293(.) 3:9356139-9430187(+)
Interaction Sequence GCUGAUGUGUCAAAUUGUGGGAGA UCUCCCACAACUUGACACAUCAGC
Interaction Site 1 - 24 5675 - 5698

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network