Basic Information


ANNInter ID ANNInter29524
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-19408 URS0002353A5A_3702
Category siRNA lncRNA
Coordinate 1:25158695-25163581(.) 4:11872630-11935520(+)
Interaction Sequence AUCUUCUGAGAUAGCUCUAACUGA UCAAUUGGAUUUAUCUCAUAAUAU
Interaction Site 1 - 24 15347 - 15370

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network