Basic Information
| ANNInter ID | ANNInter29388 |
|---|---|
| Interaction Type | siRNA - circRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-19353 | ath_circ_049422 |
| Category | siRNA | circRNA |
| Coordinate | 1:24732641-24733632(.) | Pt:55035-153618(.) |
| Interaction Sequence | AUCGA-UUUGUAUCACUUUUUACAG | AAUUGAAGGGUGAUAUAAAAUCGGU |
| Interaction Site | 1 - 24 | 91929 - 91953 |