Basic Information
| ANNInter ID | ANNInter28810 |
|---|---|
| Interaction Type | siRNA - lncRNA |
| Identification Method(s) | CleaveLand4;psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-19112 | URS000242DC86_3702 |
| Category | siRNA | lncRNA |
| Coordinate | 1:23301928-23303622(.) | 1:23300446-23308119(+) |
| Interaction Sequence | UGACUGUGCUGUAGAUCACAA | UUGUGAUCUACAGCACAGUCA |
| Interaction Site | 1 - 21 | 1888 - 1908 |
Additional Information
| Unpaired Energy (UPE) | -1 |
|---|---|
| Inhibition Mode | Cleavage |
| RNAhybrid MFE | NA |
| IntaRNA MFE | NA |
| Degradome Support | Yes |
| Allen's Score | NA |
| Category | 0 |
| Sample IDs | SRR17487786 |