Basic Information


ANNInter ID ANNInter28710
Interaction Type siRNA - circRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-19074 ath_circ_045428
Category siRNA circRNA
Coordinate 1:23149217-23150332(.) 5:25183347-25186397(.)
Interaction Sequence GAUAAACCGAUAGCGAGGAAGGCU UGUCUUGUGUGCUAUUGGUUUAUC
Interaction Site 1 - 24 2095 - 2118

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network