Basic Information


ANNInter ID ANNInter28623
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-19046 URS00023DCF72_3702
Category siRNA lncRNA
Coordinate 1:22936142-22936699(.) 1:8981795-9042750(+)
Interaction Sequence UCUCCGCCGGCGGAAGCUCGA AGGAGCUUCAGUUGGUGGAGG
Interaction Site 1 - 21 60681 - 60701

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network