Basic Information
| ANNInter ID | ANNInter27960 |
|---|---|
| Interaction Type | siRNA - lncRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-18816 | URS0002376853_3702 |
| Category | siRNA | lncRNA |
| Coordinate | 1:21450042-21457770(.) | 1:7453566-7546337(+) |
| Interaction Sequence | AUCCGGAACAUCAAUA-AGAGAAUG | UCUUCUCUGUGUUGGUGUUUUGGAU |
| Interaction Site | 1 - 24 | 44177 - 44201 |