Basic Information


ANNInter ID ANNInter27881
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-18787 URS00023AB54C_3702
Category siRNA lncRNA
Coordinate 1:21304403-21305118(.) 2:6938648-6995767(+)
Interaction Sequence CCGACCUUAGCUCUGUUGGUA UACCAACUGAGCUAAGGUCGG
Interaction Site 1 - 21 8212 - 8232

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network