Basic Information


ANNInter ID ANNInter27414
Interaction Type siRNA - circRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-18609 ath_circ_030036
Category siRNA circRNA
Coordinate 1:20333192-20335267(.) 4:5859978-5876946(.)
Interaction Sequence GGCCUAUUGUGUAUCGAUGACAUG CAUGUUAUCGAUACACAGAAGGGC
Interaction Site 1 - 24 5355 - 5378

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network