Basic Information


ANNInter ID ANNInter27238
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-18534 URS0000A77066_3702
Category siRNA lncRNA
Coordinate 1:19849631-19851932(.) 2:18702738-18703101(+)
Interaction Sequence UUCCAAAUUCCGGUGACUGAU AGUGGUCACCGGAAGUUGGAA
Interaction Site 1 - 21 98 - 118

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network