Basic Information


ANNInter ID ANNInter27211
Interaction Type siRNA - circRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-18525 ath_circ_035573
Category siRNA circRNA
Coordinate 1:19780022-19781222(.) 4:18202607-18257637(.)
Interaction Sequence AAUCAGAACUUGAACCAUCACAGU UGAGUGAUGGUUCAAGUUCUGAUU
Interaction Site 1 - 24 30352 - 30375

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network