Basic Information


ANNInter ID ANNInter26994
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-18439 URS0002396630_3702
Category siRNA lncRNA
Coordinate 1:19374451-19375470(.) 1:10300334-10375760(+)
Interaction Sequence ACCCUGAAAUCGUUGGUUUAAUAA UUGUUAAACCAACGAUUUCAGGGU
Interaction Site 1 - 24 48901 - 48924

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network