Basic Information
| ANNInter ID |
ANNInter26546 |
| Interaction Type |
siRNA - lncRNA |
| Identification Method(s) |
psRNATarget |
Interaction Information
| Type |
ncRNA Interactor 1 |
ncRNA Interactor 2 |
| ncRNA ID |
ath-b10r1-18282 |
URS00023D9318_3702 |
| Category |
siRNA |
lncRNA |
| Coordinate |
1:18493381-18494096(.) |
3:16897791-16914078(+) |
| Interaction Sequence |
AAAAGGAGUAGUUUGAAAGGGCAU |
GUGUCGUUUUAAAUUGUUAUUUUU |
| Interaction Site |
1 - 24 |
14174 - 14197 |
Additional Information
| Unpaired Energy (UPE) |
NA |
| Inhibition Mode |
Cleavage |
| RNAhybrid MFE |
NA |
| IntaRNA MFE |
NA |
| Degradome Support |
No |
| Allen's Score |
NA |
| Category |
NA |
| Sample IDs |
|