Basic Information
| ANNInter ID | ANNInter26476 |
|---|---|
| Interaction Type | siRNA - circRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-18252 | ath_circ_048196 |
| Category | siRNA | circRNA |
| Coordinate | 1:18320561-18322469(.) | Pt:9179-9343(.) |
| Interaction Sequence | AAUGAGAACUUGAACCAUCAC-UCU | AGAUGUUAUGGGUCGAAUUUUUAUU |
| Interaction Site | 1 - 24 | 48 - 72 |