Basic Information


ANNInter ID ANNInter26474
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-18252 URS00023BDC54_3702
Category siRNA lncRNA
Coordinate 1:18320561-18322469(.) 4:18229100-18268809(+)
Interaction Sequence AAUGAGAACUUGAACCAUCACUCU UGAGUGAUGGUUCAAGUUCUGAUU
Interaction Site 1 - 24 3859 - 3882

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network