Basic Information


ANNInter ID ANNInter26401
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-18220 URS0000A771A9_3702
Category siRNA lncRNA
Coordinate 1:18110637-18111486(.) 3:10964269-10964716(-)
Interaction Sequence AAGGAAGAACGGCCAUCAGAACAA AUGUUCUGUUAGUUGUUCUUCUUU
Interaction Site 1 - 24 112 - 135

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network