Basic Information
| ANNInter ID | ANNInter26347 |
|---|---|
| Interaction Type | siRNA - lncRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-18190 | URS0000A76946_3702 |
| Category | siRNA | lncRNA |
| Coordinate | 1:17997628-17998187(.) | 3:1729786-1730175(+) |
| Interaction Sequence | AAGGAGAUA-CUCACACUUAACGCC | GGGGUCAAGUGUGAGAUGUCUUCUU |
| Interaction Site | 1 - 24 | 70 - 94 |