Basic Information
| ANNInter ID | ANNInter25563 |
|---|---|
| Interaction Type | siRNA - lncRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-17912 | URS000238A2BD_3702 |
| Category | siRNA | lncRNA |
| Coordinate | 1:16773370-16774664(.) | 5:14424356-14483748(+) |
| Interaction Sequence | GCGUAGAAUCUUA-GUGAACAACUA | UAGCCGUUCACCUAGGAUUCUACGC |
| Interaction Site | 1 - 24 | 34498 - 34522 |