Basic Information


ANNInter ID ANNInter25135
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-17765 URS0002353A5A_3702
Category siRNA lncRNA
Coordinate 1:15940853-15945662(.) 4:11872630-11935520(+)
Interaction Sequence AUGGAAAUAGACACAGUAGGAAAG GUUUUUUAUUCUGUCUAUUUCUUC
Interaction Site 1 - 24 14506 - 14529

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network