Basic Information


ANNInter ID ANNInter24914
Interaction Type siRNA - circRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-17700 ath_circ_040772
Category siRNA circRNA
Coordinate 1:15497108-15502609(.) 5:9722810-9725177(+)
Interaction Sequence AAGACGAGUACAUGCCUGAACAGA GUAGCUUAGGCAUGUGCUUGUCUU
Interaction Site 1 - 24 982 - 1005

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network