Basic Information


ANNInter ID ANNInter24913
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-17700 URS000235E7DF_3702
Category siRNA lncRNA
Coordinate 1:15497108-15502609(.)
Interaction Sequence AAGACGAGUACAUGCCUGAACAGA UUUGCUUUGGUAUGUGCUUGUCUU
Interaction Site 1 - 24 28586 - 28609

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network