Basic Information


ANNInter ID ANNInter24848
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-17681 URS000241AB84_3702
Category siRNA lncRNA
Coordinate 1:15457854-15458172(.) 2:3497441-3595523(+)
Interaction Sequence UCCGGAUUCACUCAGAAACAAAGU AUUUUGCUUCUGAGUGAAUCCGGA
Interaction Site 1 - 24 52881 - 52904

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network