Basic Information
                    
                    
                    
                    
                      | ANNInter ID | ANNInter24203 | 
                    
                      | Interaction Type | siRNA - circRNA | 
                    
                      | Identification Method(s) | psRNATarget | 
                    
                     
                     
                    Interaction Information
                    
                    
                    
                    
                      | Type | ncRNA Interactor 1 | ncRNA Interactor 2 | 
                    
                      | ncRNA ID | ath-b10r1-17500 | ath_circ_029912 | 
                    
                      | Category | siRNA | circRNA | 
                    
                      | Coordinate | 1:14488520-14507580(.) | 4:5059540-5063374(.) | 
                    
                      | Interaction Sequence | AUUGUCUGUGCGAUCUCGGAGCCU | AGGCUCCUAGAUCACAUAGACAAU | 
                    
                      | Interaction Site | 1 - 24 | 1748 - 1771 | 
                    
                     
		     
    Additional Information
    
    
    
    
      | Unpaired Energy (UPE) | NA | 
    
      | Inhibition Mode | Translation | 
    
      | RNAhybrid MFE | NA | 
    
      | IntaRNA MFE | NA | 
    
      | Degradome Support | No | 
    
      | Allen's Score | NA | 
    
      | Category | NA | 
    
  | Sample IDs |  |