Basic Information
| ANNInter ID | ANNInter24033 |
|---|---|
| Interaction Type | siRNA - lncRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-17445 | URS000234B5C3_3702 |
| Category | siRNA | lncRNA |
| Coordinate | 1:14091637-14147092(.) | 4:11792317-11852541(+) |
| Interaction Sequence | AAGAAACAGGCAAUGAGAAC--GAUC | GAUCAAGUUCUCAUUGUUUGUUUAUU |
| Interaction Site | 1 - 24 | 43727 - 43752 |