Basic Information
ANNInter ID |
ANNInter23949 |
Interaction Type |
siRNA - lncRNA |
Identification Method(s) |
psRNATarget |
Interaction Information
Type |
ncRNA Interactor 1 |
ncRNA Interactor 2 |
ncRNA ID |
ath-b10r1-17413 |
URS000240ED70_3702 |
Category |
siRNA |
lncRNA |
Coordinate |
1:13902801-13920743(.) |
3:5770251-5830529(+) |
Interaction Sequence |
AGAAGGAUCGACUGUCAAACGU |
CAGUAUGAUAGUCAAUCUUUCU |
Interaction Site |
1 - 22 |
18511 - 18532 |
Additional Information
Unpaired Energy (UPE) |
NA |
Inhibition Mode |
Cleavage |
RNAhybrid MFE |
NA |
IntaRNA MFE |
NA |
Degradome Support |
No |
Allen's Score |
NA |
Category |
NA |
Sample IDs |
|