Basic Information


ANNInter ID ANNInter23739
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-17335 URS000240ED70_3702
Category siRNA lncRNA
Coordinate 1:13464860-13465403(.) 3:5770251-5830529(+)
Interaction Sequence ACCUGAACCCGAUCAAGUACCCGA UUGGAUACCUAUUCGGGUUCGGGU
Interaction Site 1 - 24 23037 - 23060

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network