Basic Information


ANNInter ID ANNInter23103
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-17164 URS000237FDB1_3702
Category siRNA lncRNA
Coordinate 1:12727950-12735273(.) 1:13223311-13224210(+)
Interaction Sequence ACUCGAAACCAAAUCUCUCGGAUG CAUCCGGGAGAUUUGGUAUCGAGU
Interaction Site 1 - 24 873 - 896

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network