Basic Information
| ANNInter ID |
ANNInter22150 |
| Interaction Type |
siRNA - lncRNA |
| Identification Method(s) |
psRNATarget |
Interaction Information
| Type |
ncRNA Interactor 1 |
ncRNA Interactor 2 |
| ncRNA ID |
ath-b10r1-16855 |
URS000240294D_3702 |
| Category |
siRNA |
lncRNA |
| Coordinate |
1:11322675-11324299(.) |
|
| Interaction Sequence |
AGAGGAGGAACAGAAGAAGAAGAC |
AUCUUUUUUUUUUUUUUUUCUUUU |
| Interaction Site |
1 - 24 |
13050 - 13073 |
Additional Information
| Unpaired Energy (UPE) |
NA |
| Inhibition Mode |
Translation |
| RNAhybrid MFE |
NA |
| IntaRNA MFE |
NA |
| Degradome Support |
No |
| Allen's Score |
NA |
| Category |
NA |
| Sample IDs |
|