Basic Information
| ANNInter ID | ANNInter21474 |
|---|---|
| Interaction Type | siRNA - lncRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-166 | URS00023E8512_3702 |
| Category | siRNA | lncRNA |
| Coordinate | 4:153915-154680(.) | 3:10643665-10702419(+) |
| Interaction Sequence | ACCCGAAAAU--CUGGAUAUUUACCC | AAUAAAAUAUCCGGGUAUUUUCGGGU |
| Interaction Site | 1 - 24 | 35209 - 35234 |