Basic Information
| ANNInter ID | ANNInter20996 |
|---|---|
| Interaction Type | siRNA - circRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-16441 | ath_circ_041236 |
| Category | siRNA | circRNA |
| Coordinate | 1:8764627-8765033(.) | 5:14404906-14463807(.) |
| Interaction Sequence | AUGGCGUGUAGUA-GAAAGACUAGC | GCUAUUUUUUCGUAUUACACGUUAU |
| Interaction Site | 1 - 24 | 13625 - 13649 |