Basic Information


ANNInter ID ANNInter20882
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-16396 URS000239BC48_3702
Category siRNA lncRNA
Coordinate 1:8460101-8460443(.) 4:18044085-18104921(+)
Interaction Sequence AGGAUUGUGGAUAAUGUCAGAGCU AGCUCUGAAAUUCUCGGCAGUCCU
Interaction Site 1 - 24 39941 - 39964

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network