Basic Information


ANNInter ID ANNInter20479
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-16235 URS00023E420C_3702
Category siRNA lncRNA
Coordinate 1:7392035-7392471(.)
Interaction Sequence AGAGGAUGACCAAAUUUGACAGCA AGCCGUGAAGUUUGGUCUUCCUUU
Interaction Site 1 - 24 14597 - 14620

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network