Basic Information
| ANNInter ID | ANNInter19393 |
|---|---|
| Interaction Type | siRNA - circRNA |
| Identification Method(s) | CleaveLand4 |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-15777 | ath_circ_028630 |
| Category | siRNA | circRNA |
| Coordinate | 1:4319782-4320522(.) | 3:22753600-22755084(+) |
| Interaction Sequence | GGAGAAUGAAUCAGUCGGUGA | UCACUGGGCUGAUUUAUUUUCU |
| Interaction Site | 1 - 21 | 913 - 934 |
Additional Information
| Unpaired Energy (UPE) | NA |
|---|---|
| Inhibition Mode | Cleavage |
| RNAhybrid MFE | NA |
| IntaRNA MFE | NA |
| Degradome Support | Yes |
| Allen's Score | 4.5 |
| Category | 0 |
| Sample IDs | SRR19454926 |