Basic Information
| ANNInter ID | ANNInter18856 |
|---|---|
| Interaction Type | siRNA - circRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-15539 | ath_circ_019355 |
| Category | siRNA | circRNA |
| Coordinate | 1:2532774-2533421(.) | 3:553793-553981(+) |
| Interaction Sequence | GUGAAAG-GAUCUGAGACUCGAGAA | UUUUCGGGUCUCGGAUUUCUUUCGC |
| Interaction Site | 1 - 24 | 6 - 30 |