Basic Information
| ANNInter ID | ANNInter18635 | 
|---|---|
| Interaction Type | siRNA - lncRNA | 
| Identification Method(s) | CleaveLand4 | 
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 | 
|---|---|---|
| ncRNA ID | ath-b10r1-15442 | URS0000A77802_3702 | 
| Category | siRNA | lncRNA | 
| Coordinate | 1:1727096-1727568(+) | 2:6131881-6132336(-) | 
| Interaction Sequence | UGGCUCUUCAUCUUCUUGAUC | UAUCAAGAAGAAUGAAGAGCUU | 
| Interaction Site | 2 - 20 | 106 - 125 | 
Additional Information
| Unpaired Energy (UPE) | NA | 
|---|---|
| Inhibition Mode | Cleavage | 
| RNAhybrid MFE | NA | 
| IntaRNA MFE | NA | 
| Degradome Support | Yes | 
| Allen's Score | 5 | 
| Category | 0 | 
| Sample IDs | SRR3143654; SRR3143655; SRR3956086 |