Basic Information


ANNInter ID ANNInter18296
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-15327 URS00023E420C_3702
Category siRNA lncRNA
Coordinate 1:759783-760598(.)
Interaction Sequence AGAAUUUGCGAUAGAACUAGGAGU ACUCCUAAUUCUAUCGCAAAUUAU
Interaction Site 1 - 24 61120 - 61143

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network