Basic Information
| ANNInter ID | ANNInter17882 |
|---|---|
| Interaction Type | siRNA - lncRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-15168 | URS00023931A8_3702 |
| Category | siRNA | lncRNA |
| Coordinate | 5:26834931-26835359(.) | 1:11166982-11261928(+) |
| Interaction Sequence | AAAAGCACGCAGAUU--AAGAAUAUU | UAUAUUUUUUAAAUUUGUGUGUUUUU |
| Interaction Site | 1 - 24 | 40537 - 40562 |