Basic Information


ANNInter ID ANNInter16929
Interaction Type siRNA - lncRNA
Identification Method(s) CleaveLand4;psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-14792 URS0000A765C6_3702
Category siRNA lncRNA
Coordinate 5:24210765-24211122(-) 3:21131995-21132801(+)
Interaction Sequence AGAAUCUUGAUGAUGCUGCAUUU AAAUGCAGCAUCAUCAGGAUUCU
Interaction Site 1 - 23 568 - 590

Additional Information


Unpaired Energy (UPE) -1
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support Yes
Allen's Score 1
Category 0
Sample IDs SRR10045987; SRR1171802; SRR19454926; SRR3143654; SRR3143655; SRR3956083; SRR3956086; SRR6041085; SRR6041097; SRR6041101; SRR7652708

Network