Basic Information
| ANNInter ID | ANNInter16929 |
|---|---|
| Interaction Type | siRNA - lncRNA |
| Identification Method(s) | CleaveLand4;psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-14792 | URS0000A765C6_3702 |
| Category | siRNA | lncRNA |
| Coordinate | 5:24210765-24211122(-) | 3:21131995-21132801(+) |
| Interaction Sequence | AGAAUCUUGAUGAUGCUGCAUUU | AAAUGCAGCAUCAUCAGGAUUCU |
| Interaction Site | 1 - 23 | 568 - 590 |
Additional Information
| Unpaired Energy (UPE) | -1 |
|---|---|
| Inhibition Mode | Cleavage |
| RNAhybrid MFE | NA |
| IntaRNA MFE | NA |
| Degradome Support | Yes |
| Allen's Score | 1 |
| Category | 0 |
| Sample IDs | SRR10045987; SRR1171802; SRR19454926; SRR3143654; SRR3143655; SRR3956083; SRR3956086; SRR6041085; SRR6041097; SRR6041101; SRR7652708 |