Basic Information
| ANNInter ID | ANNInter16603 |
|---|---|
| Interaction Type | siRNA - lncRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-14641 | URS00023726D4_3702 |
| Category | siRNA | lncRNA |
| Coordinate | 5:23139800-23140095(.) | 2:17885243-17946654(+) |
| Interaction Sequence | GUUAUGACUUUA-GUCAGCUCGCCU | UGCUGAGCUGAAAUGAAGUCAUAAC |
| Interaction Site | 1 - 24 | 39255 - 39279 |