Basic Information
| ANNInter ID | ANNInter16467 |
|---|---|
| Interaction Type | siRNA - lncRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-14589 | URS000238F7DE_3702 |
| Category | siRNA | lncRNA |
| Coordinate | 5:22673120-22676214(.) | 4:9489541-9548552(+) |
| Interaction Sequence | AUGGCUGAAG-AUAAGAUGAAGAGU | UUCCUUUAUCUUGUUCUUCAGUUAU |
| Interaction Site | 1 - 24 | 10998 - 11022 |