Basic Information


ANNInter ID ANNInter15948
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-14392 URS00023CFAB8_3702
Category siRNA lncRNA
Coordinate 5:21345174-21345764(.)
Interaction Sequence AUCGCACCCUGGAUAUUUGAAGAC GUCUUCAAAUAUCCAGGGUGCGAU
Interaction Site 1 - 24 107061 - 107084

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network