Basic Information
| ANNInter ID | ANNInter15706 |
|---|---|
| Interaction Type | siRNA - circRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-14285 | ath_circ_051521 |
| Category | siRNA | circRNA |
| Coordinate | 5:20558857-20560294(.) | Pt:107633-108000(.) |
| Interaction Sequence | AACCA-AGUAUCGAAUCAUGAGAAU | UCGUUCAUGGUUCGAUAUUCUGGUG |
| Interaction Site | 1 - 24 | 302 - 326 |