Basic Information


ANNInter ID ANNInter15586
Interaction Type siRNA - circRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-14250 ath_circ_005704
Category siRNA circRNA
Coordinate 5:20280010-20280296(.) 1:12929037-13084255(.)
Interaction Sequence AAGACGGAUUUGGAGGAACGGGUU AACCCGUCCCUCCAAAUCCGUCUU
Interaction Site 1 - 24 87383 - 87406

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network