Basic Information
| ANNInter ID | ANNInter14350 |
|---|---|
| Interaction Type | siRNA - lncRNA |
| Identification Method(s) | psRNATarget |
Interaction Information
| Type | ncRNA Interactor 1 | ncRNA Interactor 2 |
|---|---|---|
| ncRNA ID | ath-b10r1-13762 | URS000240294D_3702 |
| Category | siRNA | lncRNA |
| Coordinate | 5:17482452-17484156(.) | |
| Interaction Sequence | GGGAGAAUUGGUUACUGUUU-UGAU | AUCAUAGACAUUAAUUAAUUUUCGC |
| Interaction Site | 1 - 24 | 114069 - 114093 |