Basic Information


ANNInter ID ANNInter14250
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-13720 URS000240FE66_3702
Category siRNA lncRNA
Coordinate 5:17283566-17283824(+) 3:15984562-15995234(+)
Interaction Sequence UGAAAGGAUUACGGGUUUUGACA AAGAAAAACCUUUAGUCCUAUUA
Interaction Site 1 - 23 6997 - 7019

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network