Basic Information


ANNInter ID ANNInter14243
Interaction Type siRNA - lncRNA
Identification Method(s) psRNATarget

Interaction Information


Type ncRNA Interactor 1 ncRNA Interactor 2
ncRNA ID ath-b10r1-13719 URS00023F9DA5_3702
Category siRNA lncRNA
Coordinate 5:17281768-17282172(-)
Interaction Sequence AAACACGGAUAAUCUGAUAAAACA GGGAUUAUUAGGUUGUUAGGGUUU
Interaction Site 1 - 24 71476 - 71499

Additional Information


Unpaired Energy (UPE) NA
Inhibition Mode Cleavage
RNAhybrid MFE NA
IntaRNA MFE NA
Degradome Support No
Allen's Score NA
Category NA
Sample IDs

Network