Basic Information
| ANNInter ID |
ANNInter14129 |
| Interaction Type |
siRNA - lncRNA |
| Identification Method(s) |
psRNATarget |
Interaction Information
| Type |
ncRNA Interactor 1 |
ncRNA Interactor 2 |
| ncRNA ID |
ath-b10r1-13676 |
URS0000A775A2_3702 |
| Category |
siRNA |
lncRNA |
| Coordinate |
5:17134428-17135519(.) |
5:26138500-26138878(+) |
| Interaction Sequence |
AAUGAAAGAGGACUGUCAUAAGGC |
ACUUUGUUGUGGUCCUCUUUCAUU |
| Interaction Site |
1 - 24 |
282 - 305 |
Additional Information
| Unpaired Energy (UPE) |
NA |
| Inhibition Mode |
Cleavage |
| RNAhybrid MFE |
NA |
| IntaRNA MFE |
NA |
| Degradome Support |
No |
| Allen's Score |
NA |
| Category |
NA |
| Sample IDs |
|